GATA1
Description
GATA binding protein 1
Also known as
Species
Canis lupus familiaris
Entrez ID
480906
Addgene Alerts
You can receive an email alert when new materials related to this gene are available at Addgene.
Log in to manage alertsPlasmids containing this gene, or a homologous gene.
ID | Plasmid | Gene/Insert | PI |
---|---|---|---|
11650 | pLVUTHshGATA1-tTR-KRAB | hUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (Homo sapiens) | Aebischer |
13626 | pMT2 GATA1 | GATA1 (Mus musculus) | Rao |
61062 | pSIN4-EF1a-GATA1-IRES-Puro | GATA1 (Homo sapiens) | Slukvin |
67068 | pCellFree_G03 GATA1 | GATA1 (Homo sapiens) | Alexandrov |
85693 | pcDNA3 GATA1 | GATA1 (Mus musculus) | Del Sal |
85694 | pcDNA3 GATA1 K137R | GATA1 (Mus musculus) | Del Sal |
118352 | hGATA-1 WT | hGATA-1 (Homo sapiens) | Sistonen |
118353 | hGATA-1 K137R | hGATA-1 (Homo sapiens) | Sistonen |
120442 | EF1a_GATA1_P2A_Hygro_Barcode | GATA1 (Homo sapiens) | Mali |
138001 | pTJK482 | GATA1 (Homo sapiens) | Kingsbury |
138010 | pTJK637 | GATA1 sgRNA (Homo sapiens) | Kingsbury |
141986 | TFORF2242 | GATA1 (Homo sapiens) | Zhang |
181976 | pLeGO.sgGata1.4.RUNX1A.iG2 | GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) | Klusmann |