Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CD81


Description CD81 molecule
Also known as
Species Pan troglodytes
Entrez ID 449635

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
11588pCDM8 hCD81CD81 (Homo sapiens) Levy
54031mEmerald-CD81-10CD81 (Homo sapiens) Davidson
54875mApple-CD81-10CD81 (Homo sapiens) Davidson
55012mCherry-CD81-10CD81 (Homo sapiens) Davidson
55281mTagBFP2-CD81-10CD81 (Homo sapiens) Davidson
56248mIFP12-CD81-10CD81 (Homo sapiens) Davidson
57124mPA-GFP-CD81-10CD81 (Homo sapiens) Davidson
57311Dronpa3-CD81-10CD81 (Homo sapiens) Davidson
57594tdEos-CD81-10CD81 (Homo sapiens) Davidson
58078tdTomato-CD81-10CD81 (Homo sapiens) Davidson
86980pDUAL CD81 (GFP)CD81 (Homo sapiens) Grove
130903pCMV-Sport6-CD81-pHluorinCD81-pHluorin (Homo sapiens) Pegtel
130904pCMV-Sport6-CD81-pHujiCD81-pHuji (Homo sapiens) Pegtel
162593pCAG-HiBiT-CD81human CD81 (Homo sapiens) Somiya
162598pcDNA3.1-CD81-(TEV)-tTAhuman CD81 (Homo sapiens) Somiya
167939pcDNA3.1-CD81-(TEV)-Crehuman CD81 (Homo sapiens) Somiya
177908pcDNA3.1-CD81-(TEV)-FKBP-Mychuman CD81 (Homo sapiens) Somiya
182651pcDNA3.1-CD81-(TEV)-FKBP-SmBiThuman CD81-TEVp cleavage site-FKBP-SmBiT (Homo sapiens) Somiya
217340gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217341gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217342gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217344gCH29 (crCD81-1)crCD81-1 (Homo sapiens) Gilbert
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert