Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

KIT


Description KIT proto-oncogene, receptor tyrosine kinase
Also known as c-KIT
Species Canis lupus familiaris
Entrez ID 403811

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI  
46304SI14-Kit bKit receptor b mouse monoclonal antibody (Danio rerio) Wright Add to Cart
114293pCLXEBR-pTF-cKitcKit (Mus musculus) Salmon Add to Cart
118848MiniCoopR mitfa:KIT L576PKIT L576P (Homo sapiens) Zon Add to Cart
118849MiniCoopR mitfa:KIT K642EKIT K642E (Homo sapiens) Zon Add to Cart
118983pC-KIT1c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118984pC-KIT2c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118985pC-KIT3c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118986pC-KIT4c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118987pC-KIT5c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118988pC-KIT6c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118989pC-KIT7c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
118990pC-KIT8c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg Add to Cart
156885pD649-HAsp-KIT-Fc(DAPA)-AviTag-6xHisKIT (Homo sapiens) Garcia Add to Cart
157449pD649-HAsp-KIT-COMP5AP-AviTag-9xHisKIT (Homo sapiens) Garcia Add to Cart
184001eDrcKITeDrcKIT (Homo sapiens) Verkhusha Add to Cart
207135pBluescript II Ks(+)-ZsGreen1-SV40 PolyA-Stop cKit HDR5'HDR cKit- ZsGreen- sv40(polyA) - 3'HDR cKit (Mus musculus) Monticelli Add to Cart
217340gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert Add to Cart
217341gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert Add to Cart
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert Add to Cart