Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Actc1


Description actin, alpha, cardiac muscle 1
Also known as MGC156490
Species Rattus norvegicus
Entrez ID 29275
MGC ID BC127451

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
99690pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Mus musculus) Church
99691pAAV-CMV-dSa VP64 Actc1dCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Mus musculus) Church
99694pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) Church
128326pSB700-mouse-ACTC1-PurogRNA against mouse ACTC1 for activation (Mus musculus) Chavez