Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

KIT


Description v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
Also known as c-kit
Species Bos taurus
Entrez ID 280832

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
46304SI14-Kit bKit receptor b mouse monoclonal antibody (Danio rerio) Wright
114293pCLXEBR-pTF-cKitcKit (Mus musculus) Salmon
118848MiniCoopR mitfa:KIT L576PKIT L576P (Homo sapiens) Zon
118849MiniCoopR mitfa:KIT K642EKIT K642E (Homo sapiens) Zon
118983pC-KIT1c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118984pC-KIT2c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118985pC-KIT3c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118986pC-KIT4c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118987pC-KIT5c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118988pC-KIT6c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118989pC-KIT7c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
118990pC-KIT8c-kit proto-oncogene {promoter} (Homo sapiens) Hogberg
156885pD649-HAsp-KIT-Fc(DAPA)-AviTag-6xHisKIT (Homo sapiens) Garcia
157449pD649-HAsp-KIT-COMP5AP-AviTag-9xHisKIT (Homo sapiens) Garcia
184001eDrcKITeDrcKIT (Homo sapiens) Verkhusha
207135pBluescript II Ks(+)-ZsGreen1-SV40 PolyA-Stop cKit HDR5'HDR cKit- ZsGreen- sv40(polyA) - 3'HDR cKit (Mus musculus) Monticelli
217340gCH130 (crCD55-4_crB2M-1_crKIT-2_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217341gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217342gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert
217345gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (Homo sapiens), crFOLH1-1 gRNA: gctccagacctggggtccagttt (Homo sapiens), crCD151-3 gRNA: cgggaggccgcacccaccgcctg (Homo sapiens), crHBG-3 gRNA: ttcttcatccctagccagccgcc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens) Gilbert