Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Gata1


Description GATA binding protein 1
Also known as Eryf1
Species Rattus norvegicus
Entrez ID 25172

Addgene Alerts

You can receive an email alert when new materials related to this gene are available at Addgene.

Log in to manage alerts

Plasmids containing this gene, or a homologous gene.

ID Plasmid Gene/Insert PI
11650pLVUTHshGATA1-tTR-KRABhUbiquitin C, GFP, tTR-KRAB, shRNA against GATA1, Tet-on (Homo sapiens) Aebischer
13626pMT2 GATA1GATA1 (Mus musculus) Rao
61062pSIN4-EF1a-GATA1-IRES-PuroGATA1 (Homo sapiens) Slukvin
67068pCellFree_G03 GATA1GATA1 (Homo sapiens) Alexandrov
85693pcDNA3 GATA1GATA1 (Mus musculus) Del Sal
85694pcDNA3 GATA1 K137R GATA1 (Mus musculus) Del Sal
118352hGATA-1 WThGATA-1 (Homo sapiens) Sistonen
118353hGATA-1 K137RhGATA-1 (Homo sapiens) Sistonen
120442EF1a_GATA1_P2A_Hygro_BarcodeGATA1 (Homo sapiens) Mali
138001pTJK482GATA1 (Homo sapiens) Kingsbury
138010pTJK637GATA1 sgRNA (Homo sapiens) Kingsbury
141986TFORF2242 GATA1 (Homo sapiens) Zhang
181976pLeGO.sgGata1.4.RUNX1A.iG2GATA1 gRNA: CCTAGACCAGGAAAATCCAT (Mus musculus), RUNX1A (Homo sapiens) Klusmann