-
PurposepCAGGS/ES-M21EnvA-VSVg-WPRE, used to package pseudotyped lentivirus
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86666 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backbonepCASGS/ES
- Backbone size w/o insert (bp) 4821
- Total vector size (bp) 7919
-
Modifications to backboneadd WPRE to the 3' of the insert
-
Vector typeMammalian Expression, Mouse Targeting, Lentiviral, Synthetic Biology
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCANE-LV envelope
-
Alt nameM21EnvA-VSVg
-
SpeciesSynthetic
-
Insert Size (bp)1919
-
GenBank IDKX990266.1
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer cttcttctttttcctacagc
- 3′ sequencing primer tttcacaaattttgtaatcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CANE-LV envelope was a gift from Fan Wang (Addgene plasmid # 86666 ; http://n2t.net/addgene:86666 ; RRID:Addgene_86666) -
For your References section:
Capturing and Manipulating Activated Neuronal Ensembles with CANE Delineates a Hypothalamic Social-Fear Circuit. Sakurai K, Zhao S, Takatoh J, Rodriguez E, Lu J, Leavitt AD, Fu M, Han BX, Wang F. Neuron. 2016 Nov 23;92(4):739-753. doi: 10.1016/j.neuron.2016.10.015. Epub 2016 Oct 27. 10.1016/j.neuron.2016.10.015 PubMed 27974160
Map uploaded by the depositor.