-
PurposeAsCpf1 gRNA entry plasmid using Zea mays Ubi promoter and ribozyme processing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 86196 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepYPQ141
-
Backbone manufacturerN/A
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAsCpf1 gRNA cloning site for ribozyme cleavage
-
gRNA/shRNA sequencegRNA scaffold only
-
SpeciesAcidaminococcus sp. BV3L6
- Promoter Maize ubiquitin 1
-
Tag
/ Fusion Protein
- Hammerhead ribozyme and HDV ribozyme
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ttcccagtcacgacgttgtaaaac
- 3′ sequencing primer catggtcatagctgtttcctg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYPQ141-ZmUbi-RZ-As was a gift from Yiping Qi (Addgene plasmid # 86196 ; http://n2t.net/addgene:86196 ; RRID:Addgene_86196) -
For your References section:
A CRISPR-Cpf1 system for efficient genome editing and transcriptional repression in plants. Tang X, Lowder LG, Zhang T, Malzahn AA, Zheng X, Voytas DF, Zhong Z, Chen Y, Ren Q, Li Q, Kirkland ER, Zhang Y, Qi Y. Nat Plants. 2017 Feb 17;3:17018. doi: 10.1038/nplants.2017.18. 10.1038/nplants.2017.18 PubMed 28211909