-
PurposeExpress SpCas9 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85450 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepRSV
- Promoter pRSV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer CGGTCTAGAaatgtagtcttatgcaatac
- 3′ sequencing primer CGGACCGGTTTTATGTATCGAGCTAGGCAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe purchased a lentiviral vector with shRNA-MDM2 from GE Dharmacon (Lafayette, CO)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
We replaced the pMecp2 promoter of SpCas9 (Addgene: 60957) with a RSV (Rous Sarcoma Virus) promoter, which was amplified from a lentiviral vector for shRNA-MDM2
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-RSV-SpCas9 was a gift from Hetian Lei (Addgene plasmid # 85450 ; http://n2t.net/addgene:85450 ; RRID:Addgene_85450) -
For your References section:
The CRISPR/Cas9-created MDM2 T309G enhances vitreous-induced expression of MDM2 and proliferation and survival of cells. Duan Y, Ma G, Huang X, D'Amore PA, Zhang F, Lei H. J Biol Chem. 2016 May 31. pii: jbc.M116.729467. 10.1074/jbc.M116.729467 PubMed 27246850