pAAV hSyn1 bPAC cMyc T2A tDimer
(Plasmid
#85397)
-
Purposehumanized photoactivated adenylyl cyclase with cMyc Tag driven by neuron-specific promoter, plus red fluorescent protein
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4568
- Total vector size (bp) 7176
-
Modifications to backboneSynapsin promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namehumanized photoactivated adenylyl cyclase
-
Alt namebPAC
-
Alt nameBlaC
-
Alt nameBeggiatoa sp. PS
-
SpeciesGU461306
-
Insert Size (bp)1092
- Promoter human synapsin-1
-
Tag
/ Fusion Protein
- cMyc Tag (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tttcgccacctctgactt
- 3′ sequencing primer GTACTCGGTTTTCAGGCACAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametdimer2
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1395
- Promoter ribosomal skip sequence T2A
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGCAGAGGAAGTCTTCTAACAT
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bybPAC was a gift from Peter Hegemann, HU Berlin, Germany tdimer2 is originally from Roger Y. Tsien, UCSD
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert was described in Stierl et al J Biol Chem. 2011 Jan 14. 286(2):1181-8 and cloned behind a neuron-specific promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV hSyn1 bPAC cMyc T2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 85397 ; http://n2t.net/addgene:85397 ; RRID:Addgene_85397)