-
PurposeFor AAV-TRE-Cre based Supernova-RFP, pK168 should be used with pK170.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85039 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-Ef1a-DIO EYFP (Plasmid #27056)
- Backbone size w/o insert (bp) 5590
- Total vector size (bp) 7115
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRFP-P2A-tTA
-
SpeciesEntacmaea quadricolor, Picorna virus, E coli, HSV
-
Insert Size (bp)1525
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGAAGTTATGCAGAATGGTAGCTGGATTGTAGCTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pK168.AAV-EF1α-DIO-tTA-P2A-RFP-WPRE (Supernova) was a gift from Takuji Iwasato (Addgene plasmid # 85039 ; http://n2t.net/addgene:85039 ; RRID:Addgene_85039) -
For your References section:
Supernova: A Versatile Vector System for Single-Cell Labeling and Gene Function Studies in vivo. Luo W, Mizuno H, Iwata R, Nakazawa S, Yasuda K, Itohara S, Iwasato T. Sci Rep. 2016 Oct 24;6:35747. doi: 10.1038/srep35747. 10.1038/srep35747 PubMed 27775045