-
PurposeN-term SpCas9 piece of inducible transcriptional activator (dCas9(N)-FRB-2xNES)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62887 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePX330
-
Backbone manufacturerZhang lab
- Backbone size w/o insert (bp) 4222
- Total vector size (bp) 6205
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9 (aa 2-535)
-
Insert Size (bp)1983
-
MutationAspartic acide 10 to Alanine (D10A)
- Promoter CBh
-
Tags
/ Fusion Proteins
- NES PTK2 (N terminal on insert)
- FRB (C terminal on insert)
- NES PTK2 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer ctggagcacctgcctgaaatcact
- 3′ sequencing primer GGCTGATCAGCGAGCTCTAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySpCas9 piece was PCR amplified of PX481 (dCas9)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX855 was a gift from Feng Zhang (Addgene plasmid # 62887 ; http://n2t.net/addgene:62887 ; RRID:Addgene_62887) -
For your References section:
A split-Cas9 architecture for inducible genome editing and transcription modulation. Zetsche B, Volz SE, Zhang F. Nat Biotechnol. 2015 Feb 2. doi: 10.1038/nbt.3149. 10.1038/nbt.3149 PubMed 25643054