pPL5618_pUG_MtxR
(Plasmid
#60929)
-
PurposePCR template vector for generating methotrexate resistance cassette.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUG27
-
Vector typeLoxP flanked deletion cassette template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDihydrofolate reductase
-
Alt nameDHFR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)561
-
MutationL22F F31S
-
Entrez GeneDHFR (a.k.a. DHFR1, DHFRP1, DYR)
- Promoter TEF1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cctcgctgcagacctgcgagcagg
- 3′ sequencing primer gggcagatgatgtcgaggcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThey were gene synthesized using a commercial service, which made them according to our design.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dihydrofolate reductase gene from Homo sapiens carrying L22F and F31S mutations (DHFR*); codon optimized for expression in Saccharomyces cerevisiae. It also contains an additional F180L mutation that does not impact protein function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPL5618_pUG_MtxR was a gift from Robert Piper (Addgene plasmid # 60929 ; http://n2t.net/addgene:60929 ; RRID:Addgene_60929) -
For your References section:
Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547