-
Purposeto make Cre-ERT2 expressing stable cell line by retrovirus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRetroQ-AcGFP1-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6886
- Total vector size (bp) 8870
-
Modifications to backboneAcGFP1 is removed during cloning. Cre-ERT2 is cloned into NheI/EcoRI site by Gibson assembly
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCre-ERT2
-
Alt nameinducible Cre
-
SpeciesBacteriophage P1
-
Insert Size (bp)1983
- Promoter cmvIE
-
Tag
/ Fusion Protein
- Estrogen receptor (ERT) (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGT CTA TAT AAG CAG AGC TG
- 3′ sequencing primer CGAAGGGGCCACCAAAGAAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ERT2-Cre-ERT2 in the same retrovirus vector (pRetroQ) has too low activity in stable cell line to prevent it to be useful. pRetroQ-Cre-ERT2 made stable cell line exhibits no leaky Cre activity whereas pCAG-Cre-ERT2 transient expression does lead to leaky Cre activity.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRetroQ-Cre-ERT2 was a gift from Richard Youle (Addgene plasmid # 59701 ; http://n2t.net/addgene:59701 ; RRID:Addgene_59701)