-
PurposeTemplate for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVpuro
- Total vector size (bp) 11177
-
Modifications to backboneNone
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWe suggest using Stellar (Clontech) for growth
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9 fuse to EGFP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4887
- Promoter MSCV LTR promoter
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctcgatcctccctttatccagcc
- 3′ sequencing primer ggctgctaaagcgcatgct (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ1658-dCas9-EGFP was a gift from Bo Huang & Stanley Qi (Addgene plasmid # 51023 ; http://n2t.net/addgene:51023 ; RRID:Addgene_51023) -
For your References section:
Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B. Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. 10.1016/j.cell.2013.12.001 PubMed 24360272