pAAV-FLEX-C-RG
(Plasmid
#49101)
-
PurposeCre dependent Cerulean-E2A-SADB19 rabies glycoprotein expression, under EF1a promoter, in AAV virus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backbonepAAV-EF1a-FLEX-GTB
-
Backbone manufacturerCallaway Addgene 26197
- Total vector size (bp) 8022
-
Modifications to backboneReplaced GFP-TVA in pAAV-EF1a-FLEX-GTB with Cerulean
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCerulean-E2A-RG
-
Alt namerabies virus glycoprotein
-
Speciesrabies virus
-
Insert Size (bp)2367
- Promoter EF1a
-
Tag
/ Fusion Protein
- cerulean (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer atttgccctttttgagtttgg
- 3′ sequencing primer CAAGGCTGGTGGGCACTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original plasmid is Addgene Plasmid #26197,
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GFP-2A-TVA in pAAV-EF1a-Flex-GTB is replaced with cerulean.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-FLEX-C-RG was a gift from Troy Margrie (Addgene plasmid # 49101 ; http://n2t.net/addgene:49101 ; RRID:Addgene_49101)