pAC-EsaR-I70V/D91G/V220A
(Plasmid
#47647)
-
PurposepAC-EsaR with a208g, a272g, c659t mutations in esaR
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAC-EsaR
- Backbone size w/o insert (bp) 3880
- Total vector size (bp) 4652
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameesaR-I70V/D91G/V220A
-
Insert Size (bp)772
-
MutationChanged Isoleucine 70 to Valine, Aspartic acid 91 to Glycine, and Valine 220 to Alanine
- Promoter Plac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer gattacgcgcagaccaaaacgatc
- 3′ sequencing primer gttgaaggctctcaagggcatcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
esaR-I70V/D91G/V220A (750bp, indicated as lowercase letters in the partial sequence) is located between KpnI and BamHI sites in the same way as wt esaR in pAC-EsaR. Please see pAC-EsaR for lac promoter and terminator sequence information and plasmid map.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC-EsaR-I70V/D91G/V220A was a gift from Cynthia Collins (Addgene plasmid # 47647 ; http://n2t.net/addgene:47647 ; RRID:Addgene_47647) -
For your References section:
Directed evolution of the quorum-sensing regulator EsaR for increased signal sensitivity. Shong J, Huang YM, Bystroff C, Collins CH. ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6. 10.1021/cb3006402 PubMed 23363022