pCRII-Topo Crim1 in situ probe
(Plasmid
#45600)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45600 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCRII-Topo
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4400
-
Vector typein situ
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCrim1 in situ probe
-
Alt namecysteine rich transmembrane BMP regulator 1 (chordin like)
-
Alt nameCrim1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)440
-
Mutationinsert contains bp#4062-4502 of NM_015800.3
-
GenBank IDNM_015800 XM_128751
-
Entrez GeneCrim1 (a.k.a. AU015004)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Rev, Sp6
- 3′ sequencing primer T7, M13 Forward (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Fragment was amplified using the following primers:
TCTCAAGACTGTTGGTTGCTG
TGAACAACCAATGATAGCACAG
For in vitro transcription, use the NotI restriction digest and SP6 promoter for sense probe generation and the HindIII restriction digest and T7 promoter for antisense probe generation.
Please note that Addgene's sequencing results match bp#4062-4502 of NM_015800.3, not bp# 4708-5148 as indicated on plasmid map. The plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRII-Topo Crim1 in situ probe was a gift from Jeffrey Macklis (Addgene plasmid # 45600 ; http://n2t.net/addgene:45600 ; RRID:Addgene_45600) -
For your References section:
Neuronal subtype-specific genes that control corticospinal motor neuron development in vivo. Arlotta P, Molyneaux BJ, Chen J, Inoue J, Kominami R, Macklis JD. Neuron. 2005 Jan 20;45(2):207-21. 10.1016/j.neuron.2004.12.036 PubMed 15664173
Map uploaded by the depositor.