-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCR3
- Backbone size w/o insert (bp) 5710
- Total vector size (bp) 8760
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namealpha Klotho
-
Alt nameKl
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)3050
-
GenBank IDNM_013823
-
Entrez GeneKl (a.k.a. alpha-kl)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer cgtcgccgtccagctcgaccag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was developed by Michael Phelps during his postdoctoral research at the Yablonka-Reuveni lab.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Kl-EGFP was a gift from Zipora Yablonka-Reuveni (Addgene plasmid # 45532 ; http://n2t.net/addgene:45532 ; RRID:Addgene_45532) -
For your References section:
Expression profile and overexpression outcome indicate a role for betaKlotho in skeletal muscle fibro/adipogenesis. Phelps M, Stuelsatz P, Yablonka-Reuveni Z. FEBS J. 2016 May;283(9):1653-68. doi: 10.1111/febs.13682. Epub 2016 Apr 13. 10.1111/febs.13682 PubMed 26881702