-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40973 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGFP
- Backbone size w/o insert (bp) 5551
- Total vector size (bp) 6336
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePiggyBac transposon 3' terminal repeats
-
SpeciesSynthetic
-
Insert Size (bp)430
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer GTTATTGTCTCATGAGCGGATAC
- 3′ sequencing primer No (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namePiggyBac 5' terminal repeats
-
SpeciesSynthetic
-
Insert Size (bp)369
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer No
- 3′ sequencing primer CCCCCTGCTGTCCATTCCTTATTC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byDr.Mario Capecchi
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PBCAG-eGFP was a gift from Joseph Loturco (Addgene plasmid # 40973 ; http://n2t.net/addgene:40973 ; RRID:Addgene_40973) -
For your References section:
A method for stable transgenesis of radial glia lineage in rat neocortex by piggyBac mediated transposition. Chen F, LoTurco J. J Neurosci Methods. 2012 Jun 15;207(2):172-80. Epub 2012 Apr 11. 10.1016/j.jneumeth.2012.03.016 PubMed 22521325