pHL1355
(Plasmid
#37566)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepZ with ColE origin
-
Backbone manufacturerLim Lab
-
Modifications to backbonePlasmid modified from Rolf Lutz and Hermann Bujard, 1997
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGFP
-
Alt namegreen fluorescent protein
-
SpeciesA. victoria
-
Insert Size (bp)717
-
Mutationstart codon removed
- Promoter pConNoHindM12
-
Tag
/ Fusion Protein
- glgC leader region (N terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SphI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CTCATGA GCGGATACAT ATTTGAA
- 3′ sequencing primer cgcggatcc AAGGCCATCCGTCAGGATGGCCTT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTetR
- Promoter pConNoHind
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCTGGGATTA CACATGGCAT GGAT
- 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCsrA
-
Alt namecarbon storage regulator
-
SpeciesE. coli
- Promoter pConNoHind
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer ggccaag CTT TAATC GTACAGGGTA GTACAAATA
- 3′ sequencing primer AGCTGATACC GCTCGCCGCA GCCGAACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHL1355 was a gift from Han Lim (Addgene plasmid # 37566 ; http://n2t.net/addgene:37566 ; RRID:Addgene_37566) -
For your References section:
Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244
Map uploaded by the depositor.