-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 34632 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBAD
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemTagBFP2
-
Insert Size (bp)738
-
MutationI174A compared to mTagBFP (enhanced photostability and chromophore chemical stability)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer 5' atgccatagcatttttatcc 3'
- 3′ sequencing primer 5' GAT TTA ATC TGT ATC AGG CTG 3' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-mTagBFP2 was a gift from Vladislav Verkhusha (Addgene plasmid # 34632 ; http://n2t.net/addgene:34632 ; RRID:Addgene_34632) -
For your References section:
An enhanced monomeric blue fluorescent protein with the high chemical stability of the chromophore. Subach OM, Cranfill PJ, Davidson MW, Verkhusha VV. PLoS One. 2011;6(12):e28674. Epub 2011 Dec 8. 10.1371/journal.pone.0028674 PubMed 22174863