pGEM-GluCl_cryst
(Plasmid
#31487)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEM-HE, modified
- Backbone size w/o insert (bp) 3000
-
Vector typeFor RNA synthesis for expression in X. laevis oocytes
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB / Amp100
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC. elegans glutamate-gated chloride channel alpha, crystallized construct
-
Alt nameGluCl
-
Alt nameGluCl_cryst
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1100
-
Tag
/ Fusion Protein
- 8x-His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggtaacgccagggttttccc
- 3′ sequencing primer gtaagttggtattatgtagc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHenry Lester, Caltech
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For vector information, see: Liman et al. 1992 Neuron 9:861-871.
For RNA synthesis, linearize plasmid with NheI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEM-GluCl_cryst was a gift from Eric Gouaux (Addgene plasmid # 31487 ; http://n2t.net/addgene:31487 ; RRID:Addgene_31487) -
For your References section:
Principles of activation and permeation in an anion-selective Cys-loop receptor. Hibbs RE, Gouaux E. Nature. 2011 Jun 2. 474(7349):54-60. 10.1038/nature10139 PubMed 21572436