pBY2946
(Plasmid
#23223)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 23223 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 9674
-
Vector typeWorm Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSnAvi
-
SpeciesC. elegans (nematode); artifical
-
Insert Size (bp)977
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GAAAGAACATTGATGGGGAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
this plasmid encodes the new described SnAvi tag and additionally the unc-119 rescue sequence from C. elegans (bp4-5705)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBY2946 was a gift from Ralf Baumeister (Addgene plasmid # 23223 ; http://n2t.net/addgene:23223 ; RRID:Addgene_23223) -
For your References section:
SnAvi - a new tandem tag for high-affinity protein-complex purification. Schaffer U, Schlosser A, Muller KM, Schafer A, Katava N, Baumeister R, Schulze E. Nucleic Acids Res. 2010 Jan 4. ():. 10.1093/nar/gkp1178 PubMed 20047968