-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 22493 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneSFG
- Backbone size w/o insert (bp) 7678
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCodon optimised Calcineurin B mutant 30
-
Alt nameCNb30
-
Alt nameCNb
-
SpeciesH. sapiens (human)
-
Insert Size (bp)519
-
MutationL124T; K125-LA-Ins
-
GenBank IDGQ463597
-
Entrez GenePPP3R1 (a.k.a. CALNB1, CNB, CNB1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer ttacacagtcctgctgaccacc
- 3′ sequencing primer caagcggcttcggccagtaac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SFG.CNb30_opt.IRES.eGFP was a gift from Martin Pule (Addgene plasmid # 22493 ; http://n2t.net/addgene:22493 ; RRID:Addgene_22493) -
For your References section:
Generation of EBV-specific cytotoxic T-cells that are resistant to calcineurin inhibitors for the treatment of post-transplant lymphoproliferative disease. Brewin J, Mancao C, Straathof K, Karlsson H, Samarasinghe S, Amrolia PJ, Pule M. Blood. 2009 Sep 21. ():. 10.1182/blood-2009-07-228387 PubMed 19770360