Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

mouse b3 full length
(Plasmid #217814)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 217814 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pD2529 CAG
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ITGB3
  • Alt name
    Integrin beta 3
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Itgb3 (a.k.a. CD61, GP3A, INGRB3)
  • Promoter CAG
  • Tag / Fusion Protein
    • P2A-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
  • 3′ sequencing primer CATGTGCACCTTGAAGCG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mouse b3 full length was a gift from Timothy Springer (Addgene plasmid # 217814 ; http://n2t.net/addgene:217814 ; RRID:Addgene_217814)
  • For your References section:

    Synthetic integrin antibodies discovered by yeast display reveal αV subunit pairing preferences with β subunits. Yuxin Hao, Jiabin Yan, Courtney Fraser, Aiping Jiang, Murali Anuganti, Roushu Zhang, Kenneth Lloyd, Joseph Jardine, Jessica Coppola, Rob Meijers, Jing Li, Timothy A.. bioRxiv 2024.01.26.577394 10.1101/2024.01.26.577394