pcDNA3.1_hCAR.Variant3
(Plasmid
#209133)
-
PurposeThe ORF of human constitutive androstane receptor (CAR), variant 3 cDNA amplified from the RT human liver RNA was cloned at the NheI/HindIII sites of the pcDNA3.1(+), the mammalian expression vector.
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 209133 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1 (+)
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6475
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameconstitutive androstane receptor (CAR), Variant 3
-
Alt nameCAR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1047
-
GenBank IDNM_005122
-
Entrez GeneNR1I3 (a.k.a. CAR, CAR1, MB67)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer atgctagcgccaccatggccagtagggaagatg
- 3′ sequencing primer ttaagcttcagctgcagatctcctgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1_hCAR.Variant3 was a gift from Catharine Ross & Reza Zolfaghari (Addgene plasmid # 209133 ; http://n2t.net/addgene:209133 ; RRID:Addgene_209133)