pLV-EF1A-CD19.8H.8TM.BB.3z
(Plasmid
#200671)
-
PurposeModular CD8hinge-CD8transmembrane-41BB-CD3z CAR backbone, For Transient Expression or Lentiviral Production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV
-
Backbone manufacturerVectorBuilder
- Backbone size w/o insert (bp) 6451
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFMC63-CD8HD-CD8TM-41BB-CD3z-P2A-EGFP
-
Alt nameCD19(FMC63)-CAR, CD8 hinge, CD8 transmembrane, 41BB costim., CD3z stim domains, P2A-GFP marker
-
Alt nameContains: FMC63-scFV, CD8 Hinge domain, CD8-transmembrane domain, 41BB-ITD, CD3z-ITD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2346
-
Entrez GeneCD8A (a.k.a. CD8, CD8alpha, Leu2, p32)
-
Entrez GeneTNFRSF9 (a.k.a. 4-1BB, CD137, CDw137, ILA, IMD109)
-
Entrez GeneCD247 (a.k.a. CD3-ZETA, CD3H, CD3Q, CD3Z, CD3ZETA, IMD25, T3Z, TCRZ)
- Promoter EF1a-short
-
Tag
/ Fusion Protein
- MycTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgatgtcgtgtactggctcc
- 3′ sequencing primer tttcttccacgtcgcctgcttg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-EF1A-CD19.8H.8TM.BB.3z was a gift from Michele Bernasconi (Addgene plasmid # 200671 ; http://n2t.net/addgene:200671 ; RRID:Addgene_200671) -
For your References section:
CD276-CAR T cells and Dual-CAR T cells targeting CD276/FGFR4 promote rhabdomyosarcoma clearance in orthotopic mouse models. Timpanaro A, Piccand C, Dzhumashev D, Anton-Joseph S, Robbi A, Moser J, Rossler J, Bernasconi M. J Exp Clin Cancer Res. 2023 Nov 4;42(1):293. doi: 10.1186/s13046-023-02838-3. 10.1186/s13046-023-02838-3 PubMed 37924157