-
Purpose35S promoter-driven expression of the positive-sense TSWV L RNA segment encoding codon-optimized L (RdRp)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 196286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCB301-2μ-HDV
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFull length TSWV L antigenome encoding codon-optimized L (RdRp)
-
SpeciesSynthetic
-
Insert Size (bp)8913
-
GenBank IDOM902668
- Promoter duplicated cauliflower mosaic virus 35S promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 35S promoter/forward primer: CTATCCTTCGCAAGACCCTTC
- 3′ sequencing primer Nos terminator/reverse primer: TCATCGCAAGACCGGCAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL was a gift from Zhenghe Li (Addgene plasmid # 196286 ; http://n2t.net/addgene:196286 ; RRID:Addgene_196286) -
For your References section:
Engineered biocontainable RNA virus vectors for non-transgenic genome editing across crop species and genotypes. Liu Q, Zhao C, Sun K, Deng Y, Li Z. Mol Plant. 2023 Mar 6;16(3):616-631. doi: 10.1016/j.molp.2023.02.003. Epub 2023 Feb 7. 10.1016/j.molp.2023.02.003 PubMed 36751129