pCJR01
(Plasmid
#187888)
-
PurposeEscherichia coli plasmid with cloned regions of homology to Campylobacter jejuni chromosome flanking a NotI restriction site. pCJR01 functions as a suicide vector for integrating cloned NotI DNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187888 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBC SK+
-
Backbone manufacturerStratagene (Agilent Tech)
- Backbone size w/o insert (bp) 3334
- Total vector size (bp) 5338
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDNA insert has homology to a rRNA region of the Campylobacter jejuni chromosome with an added central NotI restriction site
-
SpeciesCampylobacter jejuni strain CDC9511
-
Insert Size (bp)2004
- Promoter none
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cgggccccccctcgacgcgtaggcggattatcaagtc
- 3′ sequencing primer accgcggtggcggcctcgccgctactgacgcaatctc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCJR01 was a gift from Gaylen Uhlich (Addgene plasmid # 187888 ; http://n2t.net/addgene:187888 ; RRID:Addgene_187888) -
For your References section:
Cloning vectors for gene delivery, integration and expression in Campylobacter jejuni. Uhlich GA, Bagi L, Gunther NW 4th. Biotechniques. 2022 Apr 13. doi: 10.2144/btn-2021-0096. 10.2144/btn-2021-0096 PubMed 35416085