pFastBac1-pGC-A
(Plasmid
#186626)
-
PurposepFastBac1 (baculovirus polyhedrin promoter) encoding HA signal peptide, TEV-protease cleavable His10-tag, and full-length human pGC-A (NP_000897.3 amino acids 33-1061; expression-optimized DNA)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186626 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFastBac1
-
Backbone manufacturerInvitrogen; purchased via GenScript
- Backbone size w/o insert (bp) 4682
- Total vector size (bp) 7877
-
Modifications to backbonenone
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNPR1
-
Alt nameparticulate guanylate cyclase A (pGC-A)
-
Alt nameatrial natriuretic peptide receptor type A (ANPR-A)
-
Alt nameANPa, ANPRA, GUC2A, GUCY2A, NPRA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3195
-
Mutationdeleted amino acids 1-32
-
GenBank IDNP_000897.3 OL860945
-
Entrez GeneNPR1 (a.k.a. ANPRA, ANPa, GUC2A, GUCY2A, NPRA)
- Promoter polyhedring
-
Tag
/ Fusion Protein
- hemagglutinin (HA) signal peptide + His10-tag + TEV protease cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer POLYHEDF, AAATGATAACCATCTCGC
- 3′ sequencing primer SV40PAR, GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenScript gene synthesis of expression-optimized DNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
N-terminal protein sequence is MKTIIALSYIFCLVFA (hemagglutinin [HA] signal peptide) + HHHHHHHHHH + GAP (from AscI site) + ENLYFQ*G (TEV protease cleavage site; cleavage at * leaves an extra G residue at the N-terminus of pGC-A).
Backbone vector is pFastBac1.
Construct design by Shangji Zhang.
Generate the bacmid in Escherichia coli strain DH10Bac cells according to the instructions from Invitrogen.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFastBac1-pGC-A was a gift from Debra Hansen (Addgene plasmid # 186626 ; http://n2t.net/addgene:186626 ; RRID:Addgene_186626) -
For your References section:
Purification, characterization, and preliminary serial crystallography diffraction advances structure determination of full-length human particulate guanylyl cyclase A receptor. Zhang S, Hansen DT, Martin-Garcia JM, Zook JD, Pan S, Craciunescu FM, Burnett JC Jr, Fromme P. Sci Rep. 2022 Jul 12;12(1):11824. doi: 10.1038/s41598-022-15798-z. 10.1038/s41598-022-15798-z PubMed 35821229