pHR-SV40-BTLAecto&tmd-PD-1icd-mGFP
(Plasmid
#180795)
-
PurposeExpression of human BTLA extracellular domain and transmembrane domain fused to PD-1 intracellular domain followed by mGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cagggacagcagagatccagtttg
- 3′ sequencing primer ccagaggttgattatcgataagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SV40-BTLAecto&tmd-PD-1icd-mGFP was a gift from Enfu Hui (Addgene plasmid # 180795 ; http://n2t.net/addgene:180795 ; RRID:Addgene_180795) -
For your References section:
PD-1 and BTLA regulate T cell signaling differentially and only partially through SHP1 and SHP2. Xu X, Hou B, Fulzele A, Masubuchi T, Zhao Y, Wu Z, Hu Y, Jiang Y, Ma Y, Wang H, Bennett EJ, Fu G, Hui E. J Cell Biol. 2020 Jun 1;219(6). pii: 151801. doi: 10.1083/jcb.201905085. 10.1083/jcb.201905085 PubMed 32437509