pDGO186N-KS1
(Plasmid
#174301)
-
PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #1 targeting the wild type polC gene.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174301 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDGO143
- Backbone size w/o insert (bp) 3587
- Total vector size (bp) 4423
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namespacer expression cassette
-
gRNA/shRNA sequenceTTTTGGGAAGTGCGTGTGAAGCGGGAGAGCTTTACCG
-
SpeciesClostridium Thermocellum
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACCTTGATGACACAGAAGAAGGCGATTTGA
- 3′ sequencing primer TTGATATGCCTCCTAAATTTTTATCTAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGO186N-KS1 was a gift from Lee Lynd (Addgene plasmid # 174301 ; http://n2t.net/addgene:174301 ; RRID:Addgene_174301) -
For your References section:
A Single Nucleotide Change in the polC DNA Polymerase III in Clostridium thermocellum Is Sufficient To Create a Hypermutator Phenotype. Lanahan A, Zakowicz K, Tian L, Olson DG, Lynd LR. Appl Environ Microbiol. 2022 Jan 11;88(1):e0153121. doi: 10.1128/AEM.01531-21. Epub 2021 Oct 20. 10.1128/AEM.01531-21 PubMed 35015978