MEK1C218C222
(Plasmid
#164640)
-
PurposeBacterial expression plasmid for His6-MEK1C218C222
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 164640 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28a
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namemitogen-activated protein kinase kinase 1
-
Alt nameMAP2K1, MAPKK1, MEK1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1242
-
MutationG(-19)F/S218C/S222C/C277S/C376S
-
Entrez GeneMAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
- Promoter T7
-
Tag
/ Fusion Protein
- His6-tag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MEK1C218C222 was a gift from Ben Davis (Addgene plasmid # 164640 ; http://n2t.net/addgene:164640 ; RRID:Addgene_164640) -
For your References section:
LanCLs add glutathione to dehydroamino acids generated at phosphorylated sites in the proteome. Lai KY, Galan SRG, Zeng Y, Zhou TH, He C, Raj R, Riedl J, Liu S, Chooi KP, Garg N, Zeng M, Jones LH, Hutchings GJ, Mohammed S, Nair SK, Chen J, Davis BG, van der Donk WA. Cell. 2021 Apr 27. pii: S0092-8674(21)00436-0. doi: 10.1016/j.cell.2021.04.001. 10.1016/j.cell.2021.04.001 PubMed 33932340