Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

JD553
(Plasmid #160392)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 160392 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR-zeo
  • Backbone size w/o insert (bp) 2076
  • Total vector size (bp) 3987
  • Vector type
    Entry clon

Growth in Bacteria

  • Bacterial Resistance(s)
    Bleocin (Zeocin), 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    wheat GRF4-GIF1 chimera
  • Species
    wheat
  • Insert Size (bp)
    1911

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGCGATGCCGTATGCCTC
  • 3′ sequencing primer CTAGCTTCCTTCCTCCTCGGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    JD553 was a gift from Jorge Dubcovsky (Addgene plasmid # 160392 ; http://n2t.net/addgene:160392 ; RRID:Addgene_160392)
  • For your References section:

    A GRF-GIF chimeric protein improves the regeneration efficiency of transgenic plants. Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol. 2020 Oct 12. pii: 10.1038/s41587-020-0703-0. doi: 10.1038/s41587-020-0703-0. 10.1038/s41587-020-0703-0 PubMed 33046875
Commonly requested with: