KRAS-P34R
(Plasmid
#158527)
-
PurposeExpresses human KRAS P34R in E. coli with amino terminal 6xHIS tag that can be removed with TEV protease.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 158527 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDNA2.0
-
Backbone manufacturerATUM
- Backbone size w/o insert (bp) 3939
- Total vector size (bp) 4500
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKRAS
-
Alt nameKirsten ras oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)507
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
- Promoter T5
-
Tags
/ Fusion Proteins
- 6xHis-tag
- TEV protease cleavage sequence
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAATTGTGAGCGCTCACAA
- 3′ sequencing primer GAACTGCCAGGCATCAAATAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KRAS-P34R was a gift from Kenneth Westover (Addgene plasmid # 158527 ; http://n2t.net/addgene:158527 ; RRID:Addgene_158527) -
For your References section:
GTP hydrolysis is modulated by Arg34 in the RASopathy-associated KRAS(P34R). Bera AK, Lu J, Lu C, Li L, Gondi S, Yan W, Nelson A, Zhang G, Westover KD. Birth Defects Res. 2020 Mar 18. doi: 10.1002/bdr2.1647. 10.1002/bdr2.1647 PubMed 32187889