pSLQ5080_pHR_PGK_sfGFP_CoV-F2
(Plasmid
#155304)
-
PurposeSARS-CoV-2 fluorescent reporter 2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155304 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8965
- Total vector size (bp) 11705
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CATTCTGCACGCTTCAAAAG
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The plasmid contains a single A nucleotide deletion in the SARS-CoV-2 N gene ORF that causes a frameshift and early termination. This change is not expected to affect plasmid function as the only ORF on the plasmid is sfGFP (the RdRP and N gene fragments occur after the stop codon and are in the 3'UTR of sfGFP).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLQ5080_pHR_PGK_sfGFP_CoV-F2 was a gift from Stanley Qi (Addgene plasmid # 155304 ; http://n2t.net/addgene:155304 ; RRID:Addgene_155304) -
For your References section:
Development of CRISPR as an Antiviral Strategy to Combat SARS-CoV-2 and Influenza. Abbott TR, Dhamdhere G, Liu Y, Lin X, Goudy L, Zeng L, Chemparathy A, Chmura S, Heaton NS, Debs R, Pande T, Endy D, La Russa MF, Lewis DB, Qi LS. Cell. 2020 May 14;181(4):865-876.e12. doi: 10.1016/j.cell.2020.04.020. Epub 2020 Apr 29. 10.1016/j.cell.2020.04.020 PubMed 32353252