pMSCVbsd-PPARD-H413W-T427I
(Plasmid
#130766)
-
PurposeVector encoding PPARD cDNA for retroviral transduction
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 130766 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMSCVbsd
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePPARD H413W-T427I
-
SpeciesH. sapiens (human)
-
MutationH413W-T427I
-
Entrez GenePPARD (a.k.a. FAAR, NR1C2, NUC1, NUCI, NUCII, PPARB)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer pMSCVseqfw (CCCTTGAACCTCCTCGTTCGACC)
- 3′ sequencing primer pMSCVseqrv (GAGACGTGCTACTTCCATTTGTC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Generated by PCR mutagenesis. Please visit https://www.biorxiv.org/content/10.1101/525576v2 for BioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMSCVbsd-PPARD-H413W-T427I was a gift from Till Adhikary (Addgene plasmid # 130766 ; http://n2t.net/addgene:130766 ; RRID:Addgene_130766) -
For your References section:
PPARbeta/delta recruits NCOR and regulates transcription reinitiation of ANGPTL4. Legrand N, Bretscher CL, Zielke S, Wilke B, Daude M, Fritz B, Diederich WE, Adhikary T. Nucleic Acids Res. 2019 Oct 10;47(18):9573-9591. doi: 10.1093/nar/gkz685. 10.1093/nar/gkz685 PubMed 31428774