pAAV-CAG-FLEx-iSeroSnFR
(Plasmid
#128486)
-
PurposeFluorescent reporter for serotonin (conditional + membrane localization tag)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 5050
- Total vector size (bp) 6907
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameiSeroSnFR
-
Insert Size (bp)1850
- Promoter CAG
-
Tags
/ Fusion Proteins
- Ig-kappa leader (N terminal on insert)
- Myc (C terminal on insert)
- PDGFR (C terminal on insert)
- cpsfGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer pCAG-F - ggttcggcttctggcgtgtgacc
- 3′ sequencing primer pCAG-C - ccaggatttatacaaggagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-FLEx-iSeroSnFR was a gift from Lin Tian (Addgene plasmid # 128486 ; http://n2t.net/addgene:128486 ; RRID:Addgene_128486) -
For your References section:
Directed Evolution of a Selective and Sensitive Serotonin Sensor via Machine Learning. Unger EK, Keller JP, Altermatt M, Liang R, Matsui A, Dong C, Hon OJ, Yao Z, Sun J, Banala S, Flanigan ME, Jaffe DA, Hartanto S, Carlen J, Mizuno GO, Borden PM, Shivange AV, Cameron LP, Sinning S, Underhill SM, Olson DE, Amara SG, Temple Lang D, Rudnick G, Marvin JS, Lavis LD, Lester HA, Alvarez VA, Fisher AJ, Prescher JA, Kash TL, Yarov-Yarovoy V, Gradinaru V, Looger LL, Tian L. Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. doi: 10.1016/j.cell.2020.11.040. 10.1016/j.cell.2020.11.040 PubMed 33333022