-
PurposeUnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signaling
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti X1 Puro DEST (Addgene #17297)
-
Backbone manufacturerEric Campeau & Paul Kaufman
- Backbone size w/o insert (bp) 9031
- Total vector size (bp) 8646
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHRE-dUnaG
-
SpeciesAnguilla japonica
-
Insert Size (bp)1300
- Promoter HRE (HIF responsive element 5x + CMV minimal promoter)
-
Tag
/ Fusion Protein
- PEST-degron and Myc tag (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer Primer 1 CACCGTACCGAGCTTTTCTCGAGC
- 3′ sequencing primer Primer 2 CAGCTGGTTCTTTCCGCCTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bythe HRE-UnaG insert was obtained from a plasmid that we received with an MTA from the Max-Planck Institute Münster, Germany
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.03.01.482530 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-HRE-dUnaG was a gift from Roland Friedel (Addgene plasmid # 124372 ; http://n2t.net/addgene:124372 ; RRID:Addgene_124372) -
For your References section:
Hypoxic niches attract and sequester tumor-associated macrophages and cytotoxic T cells and reprogram them for immunosuppression. Sattiraju A, Kang S, Giotti B, Chen Z, Marallano VJ, Brusco C, Ramakrishnan A, Shen L, Tsankov AM, Hambardzumyan D, Friedel RH, Zou H. Immunity. 2023 Jul 7:S1074-7613(23)00274-1. doi: 10.1016/j.immuni.2023.06.017. 10.1016/j.immuni.2023.06.017 PubMed 37451265