-
PurposeFor cre-dependent enriched expression of GCaMP6s in axons with cytosolic expression of mRuby3
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112008 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5109
- Total vector size (bp) 7302
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameaxon-GCaMP6s-P2A-mRuby3
-
Alt nameGAP43-GCaMP6s-P2A-mRuby3
-
SpeciesSynthetic
-
Insert Size (bp)2193
-
GenBank IDMH282424
- Promoter hSynapsin1
-
Tag
/ Fusion Protein
- GAP43 palmitoylation domain (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAAGGCGCGCTGACGTCACTCGCCG
- 3′ sequencing primer CAAATTTTGTAATCCAGAGGTTGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3 was a gift from Lin Tian (Addgene plasmid # 112008 ; http://n2t.net/addgene:112008 ; RRID:Addgene_112008) -
For your References section:
In vivo measurement of afferent activity with axon-specific calcium imaging. Broussard GJ, Liang Y, Fridman M, Unger EK, Meng G, Xiao X, Ji N, Petreanu L, Tian L. Nat Neurosci. 2018 Sep;21(9):1272-1280. doi: 10.1038/s41593-018-0211-4. Epub 2018 Aug 20. 10.1038/s41593-018-0211-4 PubMed 30127424