pHW531 (Peft-3::cGAL-C::let-858 3'UTR)
(Plasmid
#107136)
-
PurposecGAL-C driver under the control of C. elegans eft-3 promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 107136 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHW393
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS::gp41-1-C-intein::cGAL(AD)
-
Alt namecGAL-C
- Promoter C. elegans eft-3 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer oHW10f, TGAGCGGATAACAATTTCAC
- 3′ sequencing primer oHW233r, cgaattgggagacggaaagag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHW531 (Peft-3::cGAL-C::let-858 3'UTR) was a gift from Paul Sternberg (Addgene plasmid # 107136 ; http://n2t.net/addgene:107136 ; RRID:Addgene_107136) -
For your References section:
Split cGAL, an intersectional strategy using a split intein for refined spatiotemporal transgene control in Caenorhabditiselegans. Wang H, Liu J, Yuet KP, Hill AJ, Sternberg PW. Proc Natl Acad Sci U S A. 2018 Mar 26. pii: 1720063115. doi: 10.1073/pnas.1720063115. 10.1073/pnas.1720063115 PubMed 29581308