-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 10672 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMKO.1
- Backbone size w/o insert (bp) 6700
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep53 shRNA
-
Alt namep53
-
gRNA/shRNA sequenceGACTCCAGTGGTAATCTACT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)58
-
Entrez GeneTP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pLXSN 5'
- 3′ sequencing primer pBABE-3 (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also reference: Stewart, S.A., Dykxhoorn, D.M., Palliser, D., Mizuno, H., Yu, E.Y., Eisen, H.N., Sabatini, D.M., Hahn, W.C., Sharp, P.A., Weinberg, R.A., et al. (2003). RNA 9, 493
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMKO.1 puro p53 shRNA 2 was a gift from William Hahn (Addgene plasmid # 10672 ; http://n2t.net/addgene:10672 ; RRID:Addgene_10672) -
For your References section:
Telomerase maintains telomere structure in normal human cells. Masutomi K, Yu EY, Khurts S, Ben-Porath I, Currier JL, Metz GB, Brooks MW, Kaneko S, Murakami S, DeCaprio JA, Weinberg RA, Stewart SA, Hahn WC. Cell. 2003 Jul 25. 114(2):241-53. 10.1016/S0092-8674(03)00550-6 PubMed 12887925