pH3mCHSH2
(Plasmid
#101053)
-
PurposeThis is a Cryptococcus neoformans mCherry expression vector with G418 drug selection marker and C. neoformans SH2 flanking sequences for genome integration.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 101053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEMT-EASY
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 2941
- Total vector size (bp) 9120
-
Vector typeYeast Expression
-
Selectable markersG418
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCryptococcus mCherry expression plasmid
-
SpeciesCryptococcus neoformans
- Promoter Cryptococcus Histone3 promoter
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGTTGTTTCAGGCCTGCGGATG
- 3′ sequencing primer CCTTCATCAACATTCTGACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymCherry gene is cloned from plasmid pLK25 a gift from Dr. Peter Williamson from NIH.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pH3mCHSH2 was a gift from Jennifer Lodge (Addgene plasmid # 101053 ; http://n2t.net/addgene:101053 ; RRID:Addgene_101053) -
For your References section:
A fluorogenic C. neoformans reporter strain with a robust expression of m-cherry expressed from a safe haven site in the genome. Upadhya R, Lam WC, Maybruck B, Donlin MJ, Chang AL, Kayode S, Ormerod KL, Fraser JA, Doering TL, Lodge JK. Fungal Genet Biol. 2017 Sep 1. pii: S1087-1845(17)30136-6. doi: 10.1016/j.fgb.2017.08.008. 10.1016/j.fgb.2017.08.008 PubMed 28870457