-
PurposeDox-repressible cDNA expression of MAT2A (dox-off/ tet-off all-in-one vector)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 100521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerCarson Thoreen at Yale University
-
Modifications to backboneThe original pCW57.1 vector was modified: rtTA (reverse tetracycline-controlled transactivator) was replaced with tTA (tetracycline-controlled transactivator (tTA), making this vector Tet-Off. Puromycin was replaced with Blasticidin selection
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAT2A
-
Alt nameAMS2
-
Alt nameMATA2
-
SpeciesH. sapiens (human)
-
Entrez GeneMAT2A (a.k.a. MATA2, MATII, SAMS2)
- Promoter pTight TRE
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer LNCX 5' AGCTCGTTTAGTGAACCGTCAGATC 3' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-MAT2A was a gift from David Sabatini (Addgene plasmid # 100521 ; http://n2t.net/addgene:100521 ; RRID:Addgene_100521) -
For your References section:
SAMTOR is an S-adenosylmethionine sensor for the mTORC1 pathway. Gu X, Orozco JM, Saxton RA, Condon KJ, Liu GY, Krawczyk PA, Scaria SM, Harper JW, Gygi SP, Sabatini DM. Science. 2017 Nov 10;358(6364):813-818. doi: 10.1126/science.aao3265. 10.1126/science.aao3265 PubMed 29123071