CeNL_pRSETb
(Plasmid
#89510)
-
PurposeCyan color variant of bright luminescent protein for bacterial expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSETb
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCeNL
-
SpeciesSynthetic
-
Insert Size (bp)1200
-
GenBank IDLC128714
- Promoter T7
-
Tag
/ Fusion Protein
- His X 6 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CATCATGGTATGGCTAGCATGACTGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Derived from NanoLuc luciferase
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CeNL_pRSETb was a gift from Takeharu Nagai (Addgene plasmid # 89510 ; http://n2t.net/addgene:89510 ; RRID:Addgene_89510) -
For your References section:
Five colour variants of bright luminescent protein for real-time multicolour bioimaging. Suzuki K, Kimura T, Shinoda H, Bai G, Daniels MJ, Arai Y, Nakano M, Nagai T. Nat Commun. 2016 Dec 14;7:13718. doi: 10.1038/ncomms13718. 10.1038/ncomms13718 PubMed 27966527