-
PurposeIntegrate plasmid of Streptococcus pneumoniae, for chromosome integration of IPTG-inducible dCas9sp
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85588 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepJWV100
- Backbone size w/o insert (bp) 8273
- Total vector size (bp) 11911
-
Modifications to backbonegfp_sf gene was removed; dCas9sp gene driven by IPTG inducible promoter PL was inserted
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9sp
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4105
- Promoter PLsp
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site SalI (unknown if destroyed)
- 5′ sequencing primer TCTCATAGGCCGGCCTGTTAG
- 3′ sequencing primer gctttgctataaatacgcttcacag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bydCas9sp was amplified from plasmid Addgene #44249
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
To find information of pJWV100, please refer to "Overkamp W, Beilharz K, Detert Oude Weme R, Solopova A, Karsens H, Kovacs A, Kok J, Kuipers OP, Veening JW (2013) Benchmarking various green fluorescent protein variants in Bacillus subtilis, Streptococcus pneumoniae, and Lactococcus lactis for live cell imaging. Applied and environmental microbiology 79: 6481-6490";
To find information of IPTG-inducible promoter, PL, please refer to "Robin Sorg, PhD thesis, Engineering Approaches to Investigate Pneumococcal Gene Expression Regulation and Antibiotic Resistance Development, 2016, ISBN: 978-90-367-9259-2"
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJWV102-PL-dCas9 was a gift from Jan-Willem Veening (Addgene plasmid # 85588 ; http://n2t.net/addgene:85588 ; RRID:Addgene_85588) -
For your References section:
High-throughput CRISPRi phenotyping identifies new essential genes in Streptococcus pneumoniae. Liu X, Gallay C, Kjos M, Domenech A, Slager J, van Kessel SP, Knoops K, Sorg RA, Zhang JR, Veening JW. Mol Syst Biol. 2017 May 10;13(5):931. doi: 10.15252/msb.20167449. PubMed 28490437