pGM59
(Plasmid
#74785)
-
PurposeExpresses 3XFLAG::GR LBD::DAF-16A from the hsp16.48 promoter
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74785 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepABC
- Total vector size (bp) 6220
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgtaaaacgacggccagtgaattgtaatacgactcactataggg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv doi.org/10.1101/445833
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGM59 was a gift from Jordan Ward & Keith Yamamoto (Addgene plasmid # 74785 ; http://n2t.net/addgene:74785 ; RRID:Addgene_74785) -
For your References section:
A New Tool for Inducible Gene Expression in Caenorhabditis elegans. Monsalve GC, Yamamoto KR, Ward JD. Genetics. 2019 Feb;211(2):419-430. doi: 10.1534/genetics.118.301705. Epub 2018 Nov 30. 10.1534/genetics.118.301705 PubMed 30504365