-
PurposeExpresses shRNA to the vesicular GABA transporter VGAT. Cre dependent expression by flex switch
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67845 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC
- Backbone size w/o insert (bp) 2700
- Total vector size (bp) 5908
-
Vector typeMammalian Expression, Mouse Targeting, AAV, RNAi, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA
-
gRNA/shRNA sequenceVGAT
-
SpeciesM. musculus (mouse), Synthetic
- Promoter h-synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGTAATGCAGAAGAAGACTATG
- 3′ sequencing primer CCATGTAGATGGACTTGAACTC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythis plasmid is modified from the pRIME system. See: Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102, 13212–13217 We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
this plasmid is modified from the pRIME system. See:
Stegmeier, F., Hu, G., Rickles, R.J., Hannon, G.J., and Elledge, S.J. (2005). A
lentiviral microRNA-based system for single-copy polymerase II-regulated
RNA interference in mammalian cells. Proc. Natl. Acad. Sci. USA 102,
13212–13217
We used The pPRIME-CMV-dsRed-FF3 vector, a gift from Stephen Elledge (Addgene plasmid 11664), as the building block to make the AAV-hsyn-flex-dsRed-miR30-vgat2.shRNA plasmid.
transgene expression is Cre-dependent; contains flex switch
All the enzymes are unique cutters, except EcoRI and XhoI, the insert dsRed-shRNA can be retrieved using AscI and NheI, giving 1.2kb and 4.8kb bands.
The insert was read using primers in the dsred sequence:
dsred 410: CGTAATGCAGAAGAAGACTATG
dsred 530R: CCATGTAGATGGACTTGAACTC
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hsyn-flex-dsRed-shvgat was a gift from William Wisden (Addgene plasmid # 67845 ; http://n2t.net/addgene:67845 ; RRID:Addgene_67845) -
For your References section:
Wakefulness Is Governed by GABA and Histamine Cotransmission. Yu X, Ye Z, Houston CM, Zecharia AY, Ma Y, Zhang Z, Uygun DS, Parker S, Vyssotski AL, Yustos R, Franks NP, Brickley SG, Wisden W. Neuron. 2015 Jun 17. pii: S0896-6273(15)00516-4. doi: 10.1016/j.neuron.2015.06.003. 10.1016/j.neuron.2015.06.003 PubMed 26094607