pFETCh_CEBPB
(Plasmid
#64055)
-
PurposeHomology Arms and 3X Flag with P2A Neo for 3' tagging of human CEBPB
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 64055 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFETCH_Donor
- Backbone size w/o insert (bp) 5771
- Total vector size (bp) 7252
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCEBPB Homology Arms
-
Alt nameC/EBPB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1600
-
Entrez GeneCEBPB (a.k.a. C/EBP-beta, IL6DBP, NF-IL6, TCF5)
-
Tag
/ Fusion Protein
- 3X Flag P2A Neo (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acgcctgtgaaaccgtacta
- 3′ sequencing primer aactgttgggaagggcgatc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid has been used along with PX548_CEBPB_1 and PX548_CEBPB_2 to add a FLAG tag to human CEBPB in HepG2 and MCF7 cells by the Mendenhall and Myers labs at HudsonAlpha Institute for Biotechnology/UAH Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFETCh_CEBPB was a gift from Eric Mendenhall & Richard M. Myers (Addgene plasmid # 64055 ; http://n2t.net/addgene:64055 ; RRID:Addgene_64055) -
For your References section:
CETCh-seq: CRISPR epitope tagging ChIP-seq of DNA-binding proteins. Savic D, Partridge EC, Newberry KM, Smith SB, Meadows SK, Roberts BS, Mackiewicz M, Mendenhall EM, Myers RM. Genome Res. 2015 Sep 9. 10.1101/gr.193540.115 PubMed 26355004